Recombinant Pyrococcus abysii RNASEH2 was expressed in E. coli.Enzyme requirements: � monovalent cation: 50-75 mM K+/Na+ or 32 mM NH4+� divalent cation: 2-8 mM Mg++, 0.6-1.5 mM Mn++, or 0.5-0.75 mM Co++� pH 8.0-8.4� nonionic detergent: 0.01% Triton X100 or 0.01% Tween 20Temperature: RNase H2 activity is optimal around 75 centigrade, with significant activity retained with temperatures as low as 50 centigrade. It retains maximal catalytic activity at 95 centigrade for over 30 minutes.Substrates:RNA-DNA duplex with as little as a single ribose-base embedded in a DNA strand. If the substrate contains a stretch of ribose bases, cleavage will occur at multiple sites within the RNA containing strand. In the case of a single RNA containing duplex, a 3�OH and a 5�phosphate containing oligonucleotides are produced. Example S-rC 14-1-15 (RNA base lowercase)5� CTCGTGAGGTGATGcAGGAGATGGGAGGCG 3�3� GAGCACTCCACTACGTCCTCTACCCTCCGC 5�Cleavage products5� CTCGTGAGGTGATG-OH 3�/5Phos/cAGGAGATGGGAGGCG 3�5�CGCCTCCCATCTCCTGCATCACCTCACGAG 3�Maximal cleavage efficiency requires the positioning of the RNA base to be 8-10 bases in from the 5� end, and 4 or more bases from the 3� end.
Quick Search
Products 
