logo
logo
NFkB, Consensus Oligonucleotide (NF-kB, Nuclear Factor kappa B)

Cat no: N2304

NFkB, Consensus Oligonucleotide (NF-kB, Nuclear Factor kappa B)

GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold).\n\nNFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain\nenhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally identified as a heterodimeric DNA binding protein complex consisting of p65 (RelA) and p50 (NFKB1) subunits. Other identified subunits include p52, c-Rel, and RelB. The p65, cRel, and RelB subunits are responsible for transactivation. The p50 and p52 subunits possess DNA binding activity but limited ability to transactivate. p52 has been reported to form transcriptionally active heterodimers with the NFkB\nsubunit p65, similar to p50/p65 heterodimers. The heterodimers of p52/p65 and p50/p65 are regulated by physical inactivation in the cytoplasm by an inhibitor called IkB-a. IkB-a binds to the p65 subunit, preventing nuclear localization and DNA binding. Low levels of p52 and p50 homodimers can also exist in cells.\n\nApplications: \nSuitable for use in Shift and Super Shift Assays. Other applications not tested.\n\nRecommended Dilution:\nOptimal dilutions to be determined by the researcher.\n\nStorage and Stability:\nFor long-term storage, aliquot to avoid repeated freezing and thawing and freeze at -70 degrees C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Aliquots are stable for at least 12 months.

Prices direct from United States Biological

Quick response times

Exclusive Biosave savings/discounts

SPECIFICATIONS

Catalog Number

N2304

Size

500ng

Form

Supplied as a liquid in 10mM Tris, 1mM EDTA, 200mM sodium chloride, 0.01% sodium azide. No stabilizing proteins added.

Additional Info

Binds NFkB /c-Rel homodomeric and heterodimeric complexes.

Read more on Supplier website
Advertisehere
BMA Biomedicals Horizontal banner
BMA Biomedicals

Latest promotion FROM:

BMA Biomedicals
View promotion

Latest promotions

Spend less time on DNA cleanup so you can do more science. The MSB Spin PCRapace is the fastest way to purify your DNA from PCR, restriction digestion, and...

As an incentive to qualify our BSA, we are offering a 20% discount when you purchase your first 100g, 500g or 1000g of any grade of Bovine Serum Albumin....

New brilliant antibodies, and new lower prices!For flow cytometry reagents in general, \"bright is better.\" The violet-excitable BD Horizon™ BV421 and...

It is not every day that you are given something for nothing. We are giving away additional spectrophotometer software.Cecil Instruments have enhanced the...

For the past decade scientists have extensively used ATS secondary toxin conjugates to make their own targeted toxins for in vitro use.The ability to combine...

We're so sure that you'll prefer Cayman Assay kits over your present brand that we're willing to give you a free assay kit to prove it!

10% Discount on 2 Rabbit Polyclonal Antibody Service. With over 20 years experience, SDIX has developed into the premier US custom antibody producer,...

Did your supplier increase the price of Fetal Bovine Serum? Did they substitute the US Origin with USDA? Well say no more! Innovative Research is still...

Bulk Cytokines with Custom Vialing.20 - 50% off cytokines, growth factors, chemokines and more...For a limited time Cell Sciences is offering substantial...

Are you planning to have a customised antibody made for your research?Since 2000, Everest has been producing a catalog containing thousands of affinity...

Jenway’s 73 series spectrophotometer range provides four models with a narrow spectral bandwidth of 5nm and an absorbance range of –0.3 to 2.5A,...